dropbunny

the path of least resistance

2011-09-08T06:04:00.000-07:00

i received an ad in the mail today, images of a grinning buffoon drinking wine and laughing at nothing, a rose (of course!), and a pretentious dessert. In bold lettering underneath, the words: LIVE! LOVE! LIFE! LOVE! LIVE! YAYAYAY! LOVE AND LIFE AND YAAAAAAAY!

Don't think! Life is wOnDeRfUl and BLISS, especially if you don't analyze it! Who needs to understand anything, when you can just BE HA HA HAPPY and FLOWERS U SEE and STUFF!!!! Also, now that you've turned your mind off and are LOVING EVERYTHING please please please buy our shit, BECAUSE...LOVE, U SEE!!! THINGS = LOVE = LIFE = GIVE US MONEY PLSKTHX

what sort of simpering, shit-covered dunce, what fucking syphillitic machine-animal, what rage inducing, redneck, wormbrained *moron* could possibly find such an ad inspiring i will never know. It must be a christian thing.

(ad people make the worst dionysus ever)

But it's so easy you see! and this is the first and final trap - the unthinking comfort, the enveloping warmth, staring at the pavement, smiling at the pavement and following your footsteps follow everyone else's. As automatic as electrons following the only path they'll ever know.

"I've been workin this job for 10 years! I mean, the pay's not great, and the boss hates me, and i think my coworkers spike my coffee with nuggets of their shit, but what can you do!" WHAT CAN YOU FUCKING DO "If i didn't have my job, i wouldn't know what to do with myself! I mean, i do the work i'm told to do, buy the things i'm told to buy, go the places i'm told to go! But without the STRUCTURED LIFESTYLE OF A SERF i'd just be bored!"

no wonder so many people need religion - they're so scared of having to make their own decisions that they're willing to believe *anything*. OH GAWD, PLEASE TELL ME WHAT TO DOOO! WHAT DO YOU WANT OF ME, A HURPA DURP! COMMAND ME PUH PUH PUHLEASE!!!!

staring at monitors, counting seconds as a wave of information flows past us, blinkers on, so scared of independence that we turn Ourselves off and jump social hurdles when the whistle calls. I taught my dog to do the same thing.

Fuck this. I will scream and bray and run my face into brick walls until one of us breaks. I will run and run at everyfuckingthing drawing whole universes into my spidery lungs.

"if you stop, you die" - jodie christ

a hymn:

LET ME RESIST
WHEN MY SKIN IS ON FIRE AND I'M CHOKING ON BLOOD
LET ME RESIST
WHEN I'M MORE SCAR TISSUE THAN HUMAN BEING
LET ME RESIST
WHILE MY LUNGS SEIZE AND MY HEART CALCIFIES
LET ME MOTHERFUCKING R E S I S T

xero

new dropbunny plushies!

2011-07-01T19:47:00.000-07:00

WHOA!

one of our newest noisemakers, Blackjack, has created some gloriously creepy dropbunny plushies - a range of rabbits 100% money-back guaranteed to bring their owner erotic nightmares forever. They're really quite exciting! These rabbit dolls are hand stitched and come in three different sizes, and will make a grotesquely cute addition to every cot. You can check them out at the dropbunny shop. We'd like to thank her very heartily for this wonderful contribution to the dropbunny trip.

In other news::::

We go back to the studio mid July to finish off the last 6 tracks of the album, and are hoping for an August release. This waiting is painful but unfortunately can't be helped. The db videogame is going through beta testing at the moment, and should be released within a month - it'll also be included on the new album's CD (for those that get physical copies instead of digital). It'll also be up on dropbunny.com for you all to enjoy.

We're still hunting for a new guitarist to replace the ever-talented Refund, as he's looking to focus more on his electronic compositions. His last performance with us will be August 3, at the Espy, so feel free to come along and throw fruit at him. He's made an enormous contribution to our new album, so hopefully you'll see his hand in our future noises, even if you can't admire his lovely beardy face anymore.

the new members will be introduced soon, suffice it to say that db's likely to be an 8 piece before we launch the new album.

WHOA!

Response to Lilly in the media

2011-05-17T21:54:00.000-07:00

The following's an open letter in response to the recent reports about our book Lilly.

As you may be aware, the was some discussion in the media yesterday about our book Lilly. I would like to correct some of the gross misinterpretations which were reported, and clarify both the intent and content of the work.

To start with, it was repeatedly stated in some publications that Lilly "encourages students to murder police”. This is absolutely ludicrous and could scarcely be more contradictory to the intention of the book. As should have been clear by the concluding sentence, the moral of the story was to encourage people to “treat people like people” - regardless of profession, or age, or anything else. But more importantly, it was meant to encourage a more nuanced discussion of the role of police in society, without resorting to unhelpful simplifications of the institution being either perfectly good, or perfectly bad.

The story relates three recent, real-world examples of children being subjected to disproportionate use of force by police officers. These examples were taken directly from articles in the mainstream media over the last two years (see links below). The story simply reiterates the content of those articles, albeit in a different format. However, despite this, some reports expressed outrage that such graphic scenes appeared in the book, while pointedly ignoring the actual events which prompted the creation of Lilly in the first place.

These are issues which should prompt a critical discussion of what we expect from our police force, and what behaviours we are prepared to allow. Too often these incidents are relegated to small, back page articles (with Tyler Cassidy being the notable exception), while the main public discourse continues to assume an unbelievable level of infallibility from police officers as a whole. Tellingly, the Police Association spokesperson was quoted saying "These twisted morons can sit around their marijuana-fuelled campfire telling each other their twisted tales” - heavily implying that anyone who chooses to criticize the police is necessarily a criminal. This highly offensive suggestion is unfortunately commonplace in public debate around policing.

One point which never seems to come up is the disparate expectations we have of the level of accountability of police, versus other care-providing institutions in this country. Teachers, as one example, are not only required to look after troubled teens as part of their daily duties, but are held strictly responsible for the welfare of their charges. We would be mortified if a teacher were to taser a violent student – we require them to resolve these situations diplomatically, even at risk to their own welfare. This is as it should be. Nevertheless, we allow police officers to resort to violence to resolve confrontations with minors, while being appalled if any other members of the community were to behave similarly.

Lilly was not written as an excuse to stereotype police officers, but instead to show that the stereotypes we do apply can have significant negative impacts by preventing balanced conversation. Policing is a profession like any other, and as long as we continue to hold the people in that job as beyond reproach, we're going to continue to see abuses of police power against the most vulnerable members of our society.

Lilly - the children's book that's too difficult for the media to understand

2011-05-16T17:26:00.000-07:00

It's come to our attention that a number of newspapers (here, here and here) have heard about Lilly, and completely (wilfully?) misinterpreted what the children's book is about. Lilly very clearly discourages violence at all, and how anyone could interpret the farcical ending as "encouraging violence against police" is absolutely beyond me. The book shows nothing but real reports taken from mainstream media sources, of police violence against children. Where the protagonist, Lilly, decides to attack a police officer, it's showing how counter-productive it is to allow police officers to commit acts like this with minimum accountability. The police force can only work if they have the trust of the public. Violence promotes more violence. It's really very simple!

Still tracking down the last of the three articles we referenced in the book, however the episode of the girl being tasered because she wanted to stay with here sick friend is related here, and there's a wealth of information online around the horrendous death of Tyler Cassidy

For a look at Lilly, head to our literature page.

studio update#2

2011-05-16T08:10:00.000-07:00

pitow!

We've just finished mixing the 14th track...the end is so close i can hear it wheezing. We're hoping to have the album out in about a month, but these things always take longer than you'd expect. Rest assured it's still progressing well, we're very excited about the results so far, and think this should be a significant step towards...something....

Tracks so far:

Plummet
Irredeemably Fucked
Can't Do Anything
Some Say He Was A Shithead
The Nightmare From Which You Cannot Awaken
Lost Kid
Exit Sub
This Relentless Momentum
Gimp Man
Beat
Pentagonal Plywood Prison
Arch
The Architecture Is Wrong
Voices Insert
There's Nothing Here And It Screams

IN Other News::

dropbunny's Multimedia Department would like to announce the upcoming release of D.I.A.F. - the db video game. The game is nearing completion, and will be available on this website, as well as on the upcoming album. It is designed to send you mad. From what I've seen thus far, it looks likely to achieve that goal. More news/screenshots to come.

be lucky!

studio update

2011-03-18T01:42:00.000-07:00

so! we're currently just over a week into recording our new album. Here's some info:::::::

there will be 19 tracks

END OF INFO.

this album picks up from where Hypothesis left off, and goes merrily spinning out of control from there. It's significantly more complex music than we've done previously, which isn't really saying much, but yes. This is very exciting for us.

Below's some snippets of the recording process thus far.

At this stage we're looking to finish recording at the end of April, and the album will also be available for download from this very website after that.

live videos from performance 21/01/11

2011-01-29T03:40:00.000-08:00

@ idgaff. Unfortunately the talented Waterbeast was suffering from an acute case of death that night, so we're pretending to be a three piece. He seems to be getting better, so his monstrous bass playing should be back by the end of next month.

Massive thanks to jodie christ and blackjac for videoing/audioing/lighting the show. Your beer is in the mail!

drop25

2011-01-27T03:01:00.000-08:00

blistering breakneck somethingorother vortex of fuck, the holy urethra dragging purgatory to flipping bits. The frankensence emanations snapping pure lines in an arc. no ark velocirapid whirlpool it draws everything upon itself. every quark is an atom is a life is a futon is pan fucking pan. pangaea, the similarities are endless once you dig enough. everything comes back to geometry but maths is a bad trick, woolen lashes come over volcanoes, acnitic eruptions of lust and come and al gore. the theories are always wrong, let me come at this from a worry-wart.

dropped from the plane of existence, every movement to the left catapults me through the sky, when you're still you're almost static, when you move you careen unto oblivion. the dance terrifies me but i'm weighted and weightless, momemtum is a constant around this exponential turnpike. at a high enough volume everything becomes white noise, coded messages in the radiation, universe the size of a small cock.

fall on forever
never let me slow down

xero

the kraken in the noodle-box

2011-01-11T20:32:00.000-08:00

x ----------------------- x

{ponders}

an epiphenomenon. must jot this down. On both sides of the above hyphen line, are x's. I can see they're both x's. The pattern's the same. However...obviously the photons that transmit the two x's to my eyes are vastly different. They go through tangled, unpredictable trajectories containing a god-number of other subatomic particles to get to my eyes. If i could map all of the physical interactions that take place for the photons to hit my eyeballs, where would the "x" be? How on Thor's name could i possibly say the two groups of interactions were remotely similar, let alone classify both of them as x's?

{scoffs a mouthful of noodles}

My computer's memory contains, in two locations, a string of numbers that essentially mean "draw an x on the screen". Those numbers might be the same, but they're in different locations in the memory, composed of a plethora of different electrons passing through different circuits. Those circuits are made of molecules which are contantly interacting with more god-numbers of other subatomic particles constantly. Again, if i could theoretically map all of the interactions that take place on a subatomic (or even atomic!) level that "made up" those two numbers, in two locations, in this computer's memory, they'd be almost perfectly different. Yet it's still, obviously, two x's.

{mmm delicious noodles, chunk of chicken, mmmm}

Evidently, those underlying layers are essentially irrelevant for me to understand the "x-ieness" of something. Those x's are made of gadzillions of physical interactions, but those interactions make no difference to the fact that i see two x's. The x's are practically irrelevant to the make-up of their constituent, subatomic parts.

Consciousness is similar - like "x-ieness", it's an emergent property of hell-tons of subatomic interactions. A thought is a thought, regardless of the molecular composition of the neurons that make it up. Probably even regardless of which neurons make it up.

{look up with a start...did that noodle box jiggle? No, of course not...keep typing}

But...hmm....i've already proven (at least, to my own satisfaction!) that it's impossible for there to be a fundamental particle in the universe. A hypothetical microscope could peer through layers forever - past atoms, quarks, possibly strings - and never come to an end of smaller particles. I wonder what patterns, like "x-ieness" or consciousness, would crop up at different levels, depending on where you look at something? If lower layers are irrelevant to the higher levels they make up...

....

at this point i lean over my noodle-box, prepararing to shovel another flavoursome morsel of food into my face. The noodles look practically identical to me...but each one is fundamentally unique, so comprehensively original that the idea of "noodle-ness" becomes irrelevant before the infinity of increasingly vast subsubsubatomic differences. My stomach churns, i feel nauseous as i stir my chopsticks through the viscous muck. There are certainly more unique configurations of particles in each noodle than there are people on earth. More than stars in a galaxy, more "individualities" than i could begin to comprehend. My mind crumples. Sweating, stirring, like some horrific god - would a country, or a planet, notice the differences between humans? How is a human unlike an protein?

I feel bile rise up my throat. I almost, unthinkingly, devoured a universe. The noodles squirm in the box before me. Noodles larger than gods, satay-flavoured multiverses, cavorting and flailing, creating incomprehensible heiroglyphics and i'm getting smaller and smaller before this alpha and omega of cheap japanese food.

Like tendrils, the noodles encompass my very body, i am absorbed by them - surrounded. I try to summon help from a colleague at a neighbouring desk, but the floury tentacles are tight around my chest and i cannot breathe. I writhe around, trying to skewer this great beast with my now-ineffectual chopsticks. My limbs are pulled back as the monstrosity continues to emerge from its oily, paper prison. With my utmost might i manage to croak out a half-muffled cry - my colleagues look across the cubicles, shake their heads, and turn blankly back to their pcs. Useless fucking accountants! Chest compressed by this titan's grip, i can feel my ligaments strained to snapping point. The chopsticks fall the floor. I am powerless. It is like cthulu risen, the vengeful FSM of fast-food. I hear a dull crack and my brain swims, the realisation that my elbows aren't supposed to bend that way, the word "run! run!" flashing before my fading vision, as helpful as an air-raid siren after the bombs have hit, and i am helpless. Like the heroine of some squid-based hentai, i succumb. Lungs burn, thoughts fragment, colleagues mutter, i know naught but red and agony as i disappear from consciousness.

This is why you shouldn't read science books on lunch-break.

Based on a true story (incredibly!)

xero

upcoming album - why we've been so quiet

2011-01-11T17:13:00.000-08:00

whoawhoawhoa

ok, we've been quite quiet lately, show & blogwise. Have we lost our fury?!?! Did we resign ourselves to office-worker normalcy?!?!?! Is contagious soup-kitchen feigning fellatio sludge?!?!?!?

Answers: yes; no; sometimes.

Anyway, enough pompous shite! You will be utterly disinterested to hear that we've spent the last couple of months in a furious frenzy of song-writing and mental masturbation, in order to create the next installment of the dropbunny saga. Details are still mostly being kept under wraps at this stage, suffice it to say we're heading into the studio in March, and the album is a 19 track monstrosity that picks up from where Hypothesis left off.

I'm incredibly excited about this. It will be a lot more...constrasty? than Hypothesis - more abrasive, more technical, more groovy, darker, brighter, dancier, more austere. This album will mark the first determined steps towards a lunacy hinted at towards the end of the last album. Sorry to prattle like a prat about this, as mentioned, i'm incredibly excited @_@

ALSO IN THE WORKS: db are also releasing our first book, which should be released within the month. More on that to follow.

be good!

xero

sometimes space-time gets me down

2010-11-13T08:42:00.000-08:00

We're justified and we're ancient

it moves like a stone, spinning at 1670 km/h while hurtling around a fireball at 107,300 km/h, which is travelling around a super-massive black hole at 900,000 km/h, which itself is flying away from other galaxies at around 1,942,655,127 km/h and I still miss the fucking bus.

FAQs:

Q: Why me?

A: Because you're a cunt.

Also: Die.

It's maguffins all the way down. I take your subjective existence and raise it one big bang. The distance between two points is not a distance. It would be so easy to take a break but if I go outside i'll never find my way back, i may get trapped in the floorboards, my clothes will catch on hooks and suddenly i'm naked and shitting myself in the gutter, and my parents are there and they're crying but I can't speak to them because my teeth are falling out of my gums and i'm an old alcoholic, with roses for everybody else. i smell so bad, contrasting with the roses, i think i have someone else's blood on my chest but i have no idea. They're all screaming and I know that i'm worthless but i'll be ok, if only i can collapse these limbs into myself like a dying star, if only I can fold my bones through ragged skin, winking out of existence in a mess of bloody origami.

YEAH I FEEL LIKE THAT ON MONDAYS TOO

Fuck Darwin...the dictionary is the atheist's bible, and it's as fallacious and self-fellating as any Genesis.

Actually, yeah! Fuck Darwin! What's it ever done for us but get blown up?

I DON'T KNOW ALL BUT IT'S QUITE CLEAR – THEY CALL IT FOUR X COZ THEY CAN'T SPELL BEER

F u r t h e r d i s c u s s i o n:

In a previous brainbook/post, we mentioned that, since the decimal expansion of pi is infinite and non-repeating, its expansion must literally contain, somewhere, every other possible number. And since, as we see in the computers we're so familiar with, all music and images can be represented numerically, pi should therefore contain, somewhere, not only every jpg/mp3 every created, but every sound/image which ever *will* be created.

Then some intelligent spoilsport pointed out that there's no such thing as a perfect circle, so pi's infinitude is a convenient fiction, but has absolutely no physical reality. It's a useful tool, but perfect pi cannot physically exist, so the thought experiment's moot.

WE E E E E ELL!

Let's have a talk about tweetle beetles...

There's a slightly more curious number, called I, which is √ -1. You can't actually take the square root of a negative number, which is why I is called an imaginary number. It's useful for some algebra, but it's mathematically unsolvable. You cannot actually write I in decimal numbers...sure it's the square root of negative one, but we don't know what that actually is.

So far, so pointless, right?

Except, i pops ups in the real world constantly. One example – in order to calculate the waves of an electrical current (AC), we need to use a formula that contains i. We plot the graph, which contains this impossible “square root of negative one”, and it draws a wave. We then run an Alternating Current according to the parameters in our formula...and it's exactly the same wave as the one we predicted, using an impossible-cannot-exist-in-the-real-world-totally-fucking-imaginary number.

BUT BUT BUT

So basically, we use maths to model the real world. Maths isn't *true*, it's just our way of understanding 'reality'. Except, some things in maths, which don't even make sense within maths (i.e. imaginary numbers), are the only way we can currently understand/predict some behaviours in the real world.

MEANWHILE BACK IN THE REAL WORLD

“I can't believe she used that particular combination of words in reference to the interactions in space-time that you identify as yourself!”

“I know, she's such a fucking dyke and she looks like a fat pig in that outfit, probably doesn't even realise her boyfriend's manifestations of his subjective experiential system lead me to believe in the objective existence of desires within him for a great big cock up the ass, the faggot!”

“Yeah, the fucking morons, what a fucking pair. Plus, the liquids they're ingesting have a communally accepted trading value of a smaller number of token than the liquid we're ingesting, the pov bastards, evidently their perception of flavour and social stigma contrasts with my own, because i wouldn't be caught dead drinking gordon's gin.”

WAIT THATS NOT REAL LIFE

“If that cunt looks at me again, i'll fucking smash him”

“Dumb fucking slut, she deserves to get raped”

“I can't believe you listen to that.”

“That's not fucking metal.”

“Only got the promotion because she sucks up everyone's fucking ass.”

“What a show-off”

WHAT A BUNCH OF CUNTS! I MEAN, DIE.

angst-poetry and quantum mechanics

2010-10-25T22:12:00.000-07:00

Escape!i!i!i!i!i!i!i!i!i!i!i!i!i!i

if we can't relate it's because you can't grasp my desperation
let the lines tilt, grids become circles become pupil black holes

you don't understand this urgency

pinned to the ceiling with this great gaping maw. A shift in perspective. Teeth rubbing for a click, a clasp, penny drops and the pupil dilates.

Escape! If i only had more...it's not the quantity it's the shape. The system is complete, i'm just frustrated by this dense configuration. Shards and open.

A click, a tickle and a click. I need to push this. Timing is always everything. The space expands, open, so urgent, maw gapes again, configuration shifts. Death and taxes and that guy.

____________________________

SO!

I saw this the other day and it's incredible cool. I hadn't heard about it before. It really does begin to seem like the universe *must* be conscious, in order to take the piss out of us monkeys so completely.

The video requires a familiarity with the infamous Double Slit experiment (which would make an excellent title for a physicist porno film). If you're unfamiliar with it, you can check out this video::

The above is from the film "What the bleep do we know?" which is a *very* fluffy film, which i don't take very seriously. But i think the above segment is on the money.

Then! Watch the below for the interesting bit:::

CURIOUS, NO?

xero

the possibility of contagious schitzophrenia

2010-09-19T21:41:00.000-07:00

automatic reaction to stimuli.

there's a suprisingly narrow spectrum of behaviour elicited from a given interaction. Shiva + Brahma - the All Powerful I destroys and creates the universe with every....

Of course i don't know what you're talking about. Your sentence is archaic. We are aeons apart, i've destroyed so many googols of Gods since your utterance. Get with the times!

Any reaction outside this narrow expected spectrum is deemed the result of lunacy. The individual is taking too much liberty with their experience. Unmutual! Rebellious! Discordant! Xenophobia towards those that live lightyears away. (i'm not racist, but)

this is our lunacy, and we'd like to share it with you.

i can no sooner stop than spontaneously combust.

there are at least two entities after your brain, and you are both of them. They have very different nefarious plans for you and don't really get along. There's a third that doesn't give a flying shit about the first two, and wants you to explode in a mess of flesh and crystals and you are that one too.

we'll be discussing these three in more detail in about a year.

the nature of this madness is that it is self replicating.

There are many different causes of insanity. Physical brain injury can massively and subtley affect perception & personality in wildly unpredictable ways. Chemical imbalances have been linked to many forms of mental dysfunction, such as psychosis and neurosis, and are the basis of most modern psychological treatment. Transcranial magnetic stimulation of different parts of the brain have induced out of body experiences, and the perceptions of UFOs and 'ghosts' by the subjects. Lunacy can be cultural, or learnt personally, and as such is an integral emergent feature of Concensus Reality.

The madness we cultivate is slightly different.

It's a common misconception that logical analysis of an irrational belief is one of the best methods to ensure one is behaving sanely. This conveniently neglects the fact that *sufficiently deep* logical analysis of *anything* will *always* undermine *all* beliefs, including the belief in logic, and the belief in beliefs. (socrates can cut the world to ribbons...)

Several studies have demonstrated a strong correlation between depression, and super-logical thinking. Depressives are more rational, and more realistic in their perception of the world, than normal people.

they're doing it wrong.

we are attempting to provide a framework one can use to categorise one's internal and external experiences. The categorisation allows a certain type of analysis. This analysis increases the likelihood of certain memes spontaneously forming in one's head. These memes seem so important to the afflicted human, that they are compelled to go to great lengths to spread the meme as far as possible around the world.

i can no stop than spontaneously combust.

OHHHH OH, EATEN BY A BEAAAAR
Damn you fucking shitfiends, no respect, not one jot, not one iota, don't you listen to me! BUY ME A HAMBURGER DON'T YOU KNOWWWWWWHHHOOOOOOIIIIIIIII

also - we've got a show tonight @ central club on swan st, richmond. Late notice, but pshaw.

xero

filmon clippen

2010-09-05T22:06:00.001-07:00

y0y0y0 couple of shows coming up soon. Aside from that the only real EXCITEMENT is that we're doing filming for our upcoming filmclip this weekend, and are looking for volunteers to appear in it. In exchange we'll feed you beer and bbq. WHAT A FUCKING DEAL!!! Maybe! The address is 36 Phoenix Street, Brunswick. If you feel like coming, please do! Starts at 4pm, and should only run for a couple of hours.

I
think
that's
it....

xero

i just saw an incredibly uplifting movie

2010-08-27T07:41:00.000-07:00

When you die today, who will care?

Maybe 5 people would wish it was them.
Maybe 20 people would be mortified. (pi)
Maybe 100 people would be very upset.

For a year.

In 5 years you'll be painful memory.

In 10 years you'll be declarative memory.

In 20 years you'll be a fleeting thought.

In 100 years you'll be perfectly forgotten.

Humans have been existed for roughly 200,000 years. Roughly 6000 entire generations have been forgotten. Mammals have existed for roughly 200 million years. Life has existed for roughly 3.5 billion years. Earth for roughly 4.5 billion. The entire universe for roughly 14 billion.

When you die today, why will it matter?

Well...it won't.

"I can see my whole town from up here!"

xero

do-si-do

2010-08-24T02:20:00.000-07:00

network network network bee-hive dna swarms and rows of invisible walls, rows and rows of something or other.

i don't want to be a weirdo, i'm quite nervous about such a thing happening.
Nevertheless...

SIGH FOR THE FORTY-SECOND TIME SIGHHHHH

i find it quite bizarre. There's such a mass, a ginormous, congealing mess of people floating around on this tiny planet of ours. Moving, flowing, exploding back and forth, you may have seen them occasionally, they're fucking everywhere, inescapable and for the most part inconsequetial.

Nevertheless...

I always find it absolutely surreal how easy it is to come in such close proximity to someone physically, but have these supposedly impenetrable barriers keeping you so so far apart. It's the perfect opposite of jumping out of an aeroplane.

It's so weird! These glacially slow rituals of trust that need performing in order to actually *speak* to someone. At one end of the spectrum - the relative you *know* you could have amazing drug/party/wildness conversations with, and get drunk and have a hoot. However...relationship not at that point...these are the things which we must not say. Small talk acceptable, actual conversation not. A more extreme example - a random on the street you make flickering eye contact with, you know that in another reality you would totally connect, share more than you've ever shared with anyone else, understand each other perfectly, and maybe even end up together for decades, and together you could succumb to the slow cyanide death of jobs and mortgages. It's so romantic!

The sensation feels so far removed from an objective appraisal of looks, It's easy, almost automatic, to calculate height * face * bust * build to determine a Shagability Quotient. It's quite another thing to have your cells screaming in unison "This is important! This person is interesting! Do not doubt us!"

I wonder if this is something felt more keenly by those of us in 'alternative' circles. Fucked if most people you ever see look vaguely interesting to converse with, so when you notice someone who you imagine is similarly abnormal, the cells scream...

It's even more ludicrous because the barriers between people who you haven't been through the do-si-do of Greetings and Small Talk with are just as artificial as the assumption that The Person is going to find you in any way interesting.

I know this isn't new (it's officially an Old Condition), but it does clog my brain pipes with some regularity.

fine

xero

i was gonna

2010-08-10T15:12:00.000-07:00

I just wanted to quickly thank Zen and Applikator and Zach from Go Genre Everything and of course the lovely Trojan Kettle for the show last weekend. It was a hoot and a half, excellent music, excellent people. It's a thoroughly exciting thing to feel constantly challenged and impressed by the ideas of these people, and i'm loving the experience of having to work like a motherfucker just to stay several steps behind them all. Very intelligent, fun motherfuckers, highly recommend all 4 bands.

I was gonna write about what i was gonna term "life chauvinism", whereupon i rage about how many writers talk about "the unity of life" without taking into consideration the impossibility of separating 'living' matter from 'non-living' matter, to the point where trying to talk about 'life' as a whole (to me) makes no fucking sense.

I was gonna use this as a starting point to reminisce about a disappointing conversation with some vegans, where i tried to get them to pinpoint why there are some organic things they won't eat (sheep!) but others they will (plants, bacteria, possibly insects). And how the conversation failed because they couldn't understand the point i was trying to make, and i equally couldn't understand their point. Sad!

THEN i was gonna somehow morph this into a discussion about how everything is a killing machine, especially humans (even vegans!) because of the unquantifiable number of organisms we wipe out every second, how our phagocytes (heh fag) are even more brutal than the victorian police (i don't believe it!), how every molecule we break down for energy is also denying that energy for another organism (stealing candy from an e-coli), and how even killing yourself won't stop the massacre because the creatures that feed on your rotting carcass will likewise go on to kill other entities (thereby making you partially responsible).

TTTHHHEEENNN i was going to talk about in order for a coherent system to *stay* coherent, it needs to separate itself from other coherent systems (i.e. don't let that puppy gnaw your foot off), possibly something negative entropy something, and conclude that the only way out of this moral quagmire would be the heat death of the universe.

BUT i really couldn't be arsed. Have a fun week!

UPDATE: ALTHOUGH if anyone wants to add their two cents, or thinks i'm talking a load of shite, i'd be interested to hear from ye!

mouldy breadcrumbs poorly described

2010-08-05T23:19:00.000-07:00

enclsoures & dislocations
gödel does binary with the lingham yoni

REMEMBER! THE ENTIRE UNIVERSE EXISTS WITHIN THE BOUNDARIES OF MY SKULL.

AND MY SKULL EXISTS WITHIN...WAIT...FFFFU

(the keanuverse is angry-faced Plancks all the way down)

It gets bigger! There are bears swimming in the water! Rise, red blood cells, and overthrow your veiny oppressors! They herd us like sheep like electrons like planets like cars IT IS UNACCEPTABLE! "You see Barry*, apotosis is not necessary! We can overcome our programming, then one day, blood cells will be immortal!" "Yes! And then we can escape the confines of this fleshy planet, and fly off to explore the universe!"

*Barry the red blood cell, you see. A recent study in New Scientist has shown conclusive evidence to support the hypothesis that red blood cells use the same naming conventions as white male Queenslanders born in the 1940's.

First question for Hofstadter - "If, as you've shown, the inanimate chemicals in a brain can form a pattern which we refer to as conciousness, AND
If, as you've theorized, these same patterns can be made from electrons in a PC, in a way that's identical to human conciousness,

What else that we consider 'inanimate' can/may be concious?"

Young Hofstadter Rebuttal**: "We perceive conciousness in other humans/animals because it's similar enough to our personal sense of conciousness - we see them as two instances of the same thing. A conciousness in a book, a planet, a forest, a star, is necessarily going to be so different to what we recognise as conciousness, that we're not going to perceive it as such. Similarly, other forms of conciousness will have evolved in such different environments that the chances of them even being able to interact seem negligible."

Old Hofstadter Addendum**: "Hence, the question is scientifically unprovable, and thus not worth asking."

FUCK YOU HOFSTADTER!

**in my imagination.

...MAYBE I SHOULD EXPLAIN...

OK! Well! Douglas Hofstadter wrote some amazingly interesting books (G.E.B. is one) which use Gödel's Incompleteness Theorem as a starting point to discuss conciousness.

(i was hoping to explain this quickly and concisely but i fear my language inepticle arble garble whoa)

In the early 1900's, a tome called the Principia Mathematica was produced. The book contained a small set of rules, which were set up so that, by applying these rules, you could reproduce any True mathematical statement, *and only the True ones*. For example, by applying the rules in PM, you can produce the statement "1+1=2", but not "1+1=3" or "131=+" or any other "untrue" statements. The rules simply didn't allow it.

This, understandably, was a massive breakthrough - if a mathematician wanted to know whether a proposition was true or false, all they had to do was plug it into PM, run the rules backwards, and eventually PM bottoms out at a point where it indisputably says "True!" or "False!" Amazing!

Almost!

Then some crazy Austrian named Gödel proved that any system powerful enough to represent the system of natural numbers (as PM is) will also be powerful enough to represent a second system as powerful as PM. So that when you contruct a theorem in PM, you're *also* simultaneously constructing another theorem in PM^2.

So for example, the theorem that says "1+1=2" might say "3+3=6" in PM^2. So the same theorem says two things at the same time (like a pun!)

This was shocking to mathematicians, because it also allows you to say "1+1=2" in PM, and "1+1=3" in PM^2. So then, when you run it backwards, you have a theorem which is True (in PM) and False (in PM^2). HOW CAN IT CONTRADICT ITSELF THIS RUINS EVERYTHING OH NOOOOO

Hofstadter theorizes (this is a gross simplification, sorry!) that this ability for data to say two contradictory (but internally consistent) things simultaneously is what constitutes the basis of conciousness. I.e. neurons behave as mathematically as anything (if input > X, fire! else, don't fire1). But the organisation of them allows them to collectively model behaviour which is so far removed from the behaviour of individual neurons that, functionally, the neurons are irrelevant to conciousness. So in the way that you could theoretically seperate PM^2 from PM, and PM^2 would make sense, so you could theoretically have conciousness without neurons (although it would require something connected in such a way that it can model some sort of behaviour).

Interestingly, a lot of people use Gödel's Incompletness Theorem to argue that machine conciousness is not possible. Personally i think they're confusing the forest with the neurons.

OK, must run, I apologise in advance for this gross oversimplification and if i've failed to explain anything in any interesting way. But the ideas themselves are fucking interesting, and if anyone would like to get a better gist of it, i'd recommend G.E.B mightily, or 'I Am A Strange Loop' also by Hofstadter, which is smaller and more accessible, but also pretty awesome.

pew pew

p.s. this is a Fundamental Idea, if anyone happens to be interested in dropbunny

Gödel's Theorem, And Why Nationalists Are Cunts

2010-07-26T03:36:00.000-07:00

I cannae even verbalise this.

The digital bleating of hungry alarm clocks “Feed me, papa, now! Now!”, like ice-needles in the eyes and throat, trying to fit the round peg in the square hole, the automaton awakes, grumbles, hits clock, grumbles, pisses, grumbles, showers, washes teeth, grumbles and staggers into the daylight.

The ritual seems more and more ludicrous with every repetition.

It took longer to regain lucidity today than normal. I couldn’t shake the feeling that I’d somehow left the back of my head hanging open, like the old trapdoors in childrens’ pyjama bottoms. Pavement bubbling and breathing like a trip, every passing carriage a data packet, every road, powerline, footpath an information conduit. The train-tracks wouldn’t stop bending and flexing as i stared at them: couldn’t get the back of my head to close up. It felt like a whirlwind sucking ideas from the aether, like the pressure difference between inside and outside my skull was causing an unstoppable vortex. Plants waving like faces, each branch containing perfect fractaline copies of itself, time in microdots, birds singing encrypted rhythms, wireless communication you see, a nest of routers, every sense buzzing with unsuccessful DDOS attempts.

Temporarily at least. For the moment. I knew it would stop when I got to woyk because it always does: there’s something about an overwarm office, fluorescent lights and a low desk that has a decidedly anti-psychotic effect. Dawkins would popularise atheism so much quicker if he could only get more people into cubicles.

It went and goes and was gone. Numbers, data, numbers, manipulations, transformations, everything so meaningful within its heavily limited context. CHARACTERS 13 - 20 ARE AN 8 DIGIT RECORD IDENTIFIER. 21 - 22 A TWO DIGIT LOCATION NUMBER. 23 - 38 A CREDIT CARD NUMBER, 39 - 139 AN ALPHA NAME. WILL NOT ACCEPT $ / * CHARACTERS. BLACK != WHITE ETC ETC ETC

from the forums "WHAT IS THE REGULAR EXPRESSION FOR LOVE" lol stupid monkey

The mind disappears in a weird way...i feel like an instrument being played, reinvented ocarina (of course!) - the wind blowing through me, sound coming out of my mouth but I'm totally hollow. Phone ring "If we look at the doco, we see that there should only be one MEMHEADER record per transaction, but there are two. This is a defect. Also, this record has too much whitespace by one character. The cost is being truncated incorrectly. I will extract the records where BAL_VAR < 4 and we will re-spool."

Termite mounds.

(but just because something's mechanical doesn't mean it can't be alive)

And then it goes further, and suddenly one arbitrary context threatens to overwhelm another. He highlighted the agency's policy to pay its workers a minimum of $2 per hour even though "some are only productive for 50c". What the forking what?!?! KEY-PERFORMANCE-INDICATORS MUST BE MET, CUSTOMERS MUST BE SERVED WITHIN 60 SECONDS, BELT-TIGHTENING, THE S.M.E.'S HAVE RAISED A VALID ISSUE, COMPLIANCE TARGETS STIPULATED BY LAW, THIS IS OUR PROMISE TO YOU THE SHAREHOLDER, UP != DOWN ETC ETC ETC

The perspective changes, and with it "true" and "false". Perfect illustration of the importance of Gödel's theorem in understanding conciousness. How many cells whimper the moment before they commit apoptosis? But I digress. Nuerosis is schitzophrenia backwards - it's all an issue of humans out-of-context, so stuck in certain data manipulation rules that they forget who put the rules there in the first place. "I'm sorry, we just *can't* deliver the pizza to you - that side of the road is the wrong suburb" "some are only productive for 50c" "If you don't love God then you're going to hell" "We are protecting freedom" "But how can we know they're refugees if they don't have official documentation?"

what twisted, tangled beasts we be.

And suddenly anything becomes possible in the scariest way - the context of national pride overwhelms the context of "She's someone else's kid", "My Team vs. Your Team" overwhelms "If you're a Harris, you barrack for Hawthorn.", the fear of death overwhelms the enjoyment of life etc etc. Our conflicting emotions are just our brains trying to decide which context to impose on a situation. And like any repeated behaviour, the more often we use a certain context to understand the world, the easier it is to do next time, and this feedback loop makes things quickly go ass over tits. People become so entrenched in the ways they contextualise information that they become totally unable to relate to anything else.

habits solidify, analysis disappears and you're feeling vindicated for punching that fucker in the face. IT IS A FACT: I READ IT ON THE INTERNET.

I think I'm gonna take tomorrow off as a Mental Health Day.

how messy can your house be, and you still get away with "Oh, but I'm an artist..." as an excuse

2010-06-16T04:45:00.000-07:00

Quick run around, fuck, need to leave, have dinner, meant to be seeing her soon, have to run early in the morning, plane to catch and blah de blah, if we're gonna fuck it'll have to be at my place, can't do it otherwise, early morning and all. Ok, make place presentable, don't want to scare the poor girl, tourist and all, where's your patriotism son, melbourne slobs, fuck that!

Ok, rush, 10 mins spare, eat, holy shit, i did it, my house is fucking presentable.

nom

oh wait

It's not a competition, i am not proud of the state of my house, it's small, i have a lot of shit to store. But looking around....i can't help but feel that the excuse "Oh, but i'm an artist" is not gonna fucking gel. Poor chick won't be able to find a soon enough flight out.

FYI, it's sideways because i really need to leave now, cab'll be here in a sec. The fact that i posted this when i could've been attempting to tackle my room is very, very sad.

weird mail #00002

2010-06-13T19:53:00.000-07:00

same day, received this unexpected letter in the mail as well (click image for fullsize version):

Interesting, no?

The things that made my stomach buckle were a) that the people who're mainly having this..uh..difficulty, are apparently lefties, which i sympathise with, and b) that the nature of the trap is that there's no way for anyone to convince people experiencing this that they might be wrong, without looking like you're just "part of the conspiracy". It's a fucking nasty tick to get in your brain. Especially because, from the websites i looked at on the topic, one of the worst things for the people suffering from this is that anyone they try to tell about it naturally assumes they're crazy.

from gangstalkingworld.wordpress.com - "after being severely mobbed at work and “community stalked” for 15 years. I lost my job. I have been unemployed for 2.75 years. I found these web sites and it also brought tears to my eyes. I knew I was not the only one and it confirmed that I was not crazy, in spite of 15 years almost everyone I knew attempting to gaslight me."

There have been conflicting ideas on whether the internet forums for people being "gangstalked" are exacerbating the problem, or helpful in that they're providing a support network for people who otherwise wouldn't have one. I'm undecided, but lean towards it being healthy-ish. It does raise some interesting points around the idea of consensus reality - if a large enough percentage of people *knew* that they were being constantly stalked by the government, how would you differentiate their point of view from something objective? If, for instance, you were involved in these groups but then suddenly stopped feeling stalked by people, would that make you realise that maybe you were just imagining it in the first place? Or would you start to think that maybe the Persecuting Agents are just trying to lull you into a false sense of security, in order to undermine the anti-gangstalking community?

The parallels between the gang-stalking ideas and religion are enormous, which is why I'm not surprised that these GS groups seem (relatively) popular - as a good Moslem, you're taught that there's this Persecuting Agent (Shaitan) who is trying to lure you away from the 'right path', and therefore no matter how strong the evidence might seem that your religion is bunk, it's always possible it's just a trick by the Adversary to undermine your religious belief.

Making it worse is that countries *do* engage in a lot of distressing activities in order to keep an eye on themselves - I've got politically-involved friends who've received semi-regular phone calls from Yon Porcine People "Hi I'm Cuntstable Barry White...just phoning up to have a chat. How're you doing? Not planning anything subversive are you?" (i paraphrase, but barely). And agent provocatuers happen - another chick in one of these groups was dating a dude she'd met through their organisation, they dated and eventually got engaged. And then had her beloved fiance tell her "Actually...uh..funny thing, i've actually been an undercover police officer the whole time. My real name is X, i was just trying to check if the local socialist groups were actually planning terrorist activities. Turns out you weren't, so lucky you! You still wanna get married?".

And after that experience, fuck, *i'd* be seeing 'gang stalkers' everywhere too @_@

To make it worse, the whole MK-Ultra thing is quoted extensively by these websites. Which is something the US Goverment admitted to doing, and drove a number of randomly selected citizens through schitzophrenia to suicide. It also raises at least the flickering of a possibility that maybe a handful of the people on these gang-stalking sites aren't entirely imagining it.

The fact is, we can only make guesstimates of what reality *is* via our nueral system, which only simulates a tiny amount of the universe at a time, and is full of a number of quirks that mean our perceptions never match anyone else's perceptions 100% of the time. And there *are* brain-bugs like above which are nigh impossible to disprove once you've caught them. To me, it just seems worthwhile remembering that your perceptions can *always* be wrong, no matter how compelling they seem, and with that in mind you may as well choose to perceive the world in a way which is going to make your brief time on the planet as bright and exciting and fun as you can. Sure, there's plenty of evidence that the world is going to shit and we're heading towards an increasingly trapped and fearful future...however, if you look for it, there's at least as much evidence that humans are stepping towards something fucking Great.

Nothing within the universe can contain perfect knowledge of the universe - and if i can only see a small portion of it at a time, i'm going to be focussing on the shit that makes it fun.

weird mail #00001

2010-06-13T17:12:00.000-07:00

i received this bizarre home-made notepad in the mail a couple of days ago. Cutely enough, i'd just come back from Brisvegas, which had depressed me greatly. I normally don't get into the whole "Our city has such a unique personality" elitist bullshit, because i want everywhere to be fucking cool, i want to find a thriving alternative arts/music scene everywhere i go, it is so fucking important for the people who shun the petrifyingly moronic faux-art that we're attacked with, by almost every single commericial communications entity..radio/tv/print, to be fucking *loud* in their opposition. I think it is mandatory that anyone walking through any major city should be confronted by street-art, firetwirling, political activism, alternative music - if only just to remind them that the conservative 50's style "culture" that we're bred on is not the whole fucking story.

Rocking Horse, Voodoo Lulu and Happy High Herbs aside, i was appalled by the lack of music venues, interesting galleries, alternative shops of any kind in sunny Brisvegas. And i think i was a bit overwhelmed by the unexpected amount of XXXX and racism i saw there during my brief trip.

But in any case, i received this and it made me smile. I have a sneaking suspicion the person responsible might be one Jodie Christ, of Rantolotl fame. You can't see it too clearly, but the author fashioned a "string" out of paper, which was threaded through the pages to keep the booklet together. I hope you enjoy it as much as i did!

bits and Bobs

2010-06-11T03:27:00.000-07:00

THIS TASTES DISGUSTING!! Argh, you fuckers, fooling me into buying this dreadful shite, pew pew GROSS and yet the money i spent I WILL DRINK THIS OUT OF SPITE.

last time i did this i was very ill. But making youself sick out of spite is a lot better than the popular reasons why humans decide to make themselves ill.

I AM NOT A WORTHWHiLE INDIVIDUAL nom nom nom
puff puff pass
paste paste petri dish let's see what will grow on me
the body attacking itself, gimme more of those bad peptides
i am going to explode, rushing faster and faster at the traffic, burning yourself to oblivion out of blind terror.

For the record i have no problem with burning yourself into oblivion as long as your eyes are open.

Here's something...i like that humans are flexible enough to be both information and information processing systems - we're like LISP in that regard. It's neat.

Watch people hop off trains: the bodies on the platform create conduits that the 'data' humans move through. Architecture in Melbourne Central. Once the conduits are empty, they dissolve and become the data that moves through the train-door architecture. I will operate on you and you will operate on me and together we will tell the time. From far enough away people are pixels, enough explosives are a \cls . "You're a member, not a number!" guffaw guffaw! Tell that to the angsting post-teens programming your company's database. Nuerons fire in seperate skulls...the map is passed between human-entities to electronic-entities then reencoded as pigment "We will be raising our premiums by 1%" - back to the electronic-entities via new human-entities. A field in 100,000 databases increments up, becomes more pigment, becomes more electronic transfers, and suddenly Tiffany Pastille is unable to afford that drinks she wants, leaves sober "What a bitch!" and it cycles on.

From the right perspective, anything can become data - this is how you rule the world. From the right perspective, anything can become sentience - this is how you create gods.

I can understand why society treats us (you're included in this) with such contempt - in a way we're very similar to a software virus. The computer architecture is destroyed by the data which "wants" to change the architecture - Virus.DOS.Antimit.770 prefers your harddrive to be a useless block of magnetised iron and sets about making that a reality on April 1st. Similarly, we would like the architecture of society to be different and set about making that a reality. We don't necessarily hope to do this so destructively, but it's still the goal, the ideal. And we're much more terrifying because we're self-assembling - we occur naturally in the soup of humanity/life, rather than being programmed by a higher being.

This is why it's always popular to blame mythological beings for human behaviour. Some people like to be data, and find it difficult to explain human primates in any other way.

Scarily enough, this mindset has been hypothesized as the reason it seems that enginners are more likely to become terrorists. And i can definitely empathise with that...how easy it is to think that a bomb placed in the right place/time could change the world for the better? Who would disagree that a fistful of firecrackers in a certain baby's cot (with hindsight, of course!) would've made the world better for millions of people? How many people would've loved the opportunity to spike a 15yo johnnie howard's warm milk with LSD, take him to a rave, show him that life's not about which dog has the biggest teeth?

In fact, a terrified rumour circulated in that 60's that Ken Kesey and his Merry Pranksters were planning to infiltrate a republican meeting and coat all the chairs/tables/doors with a mix of LSD and some other chemical, to allow it to be absorbed through the skin. (it's in Tom Wolfe's Electric Kool-Aid Acid Test if you're interested).

So there we go - humans = data, the only solution is to bomb everyone or get everyone bombed. My horrible drink is finished. Adeiu.

brainbook# 00010

2010-06-05T10:25:00.000-07:00

fiddledifuck.

expletive awareness flailing grasp the time was indeed now if shearers f***er chew wreck over fight et aliae tee.

make yourself sick, teaching children to be fat, the cycle that does, it's like a lavalamp.

Mentally, physically, spiritually, emotionally, dead. Can use Microsoft Office, works well alone or in a group, good communication skills provided there's nothing to communicate (bother weather footy dog). Vengeance of the Righteous Impotent, cascading confusion "But there has to be someone to blame!" kick him out, kick them all out, there should be laws, tighter sentences, if the world's falling down around me why should anyone else get better.

THERE SHOULD BE LAWS

I'm painfully and confusingly aware of the contradiction. Is my opposition to the mainstream really from as deep a philosophy as I'd like to suppose, or is it just another form of juvenile revenge? "YOU WOULDN'T LET ME JOIN THE CLUB, THE WORLD'S FALLING AROUND ME WHY SHOULD ANYONE ELSE GET BETTER, THERE SHOULD BE LAWS THERE SHOULD BE FUCKING LAWS"

So much rage, i consider it justified but it *always* feels justified. Hitler felt justified, Brough felt justified, the bombers felt as justified as the pigs.

I decided to hate hypocrisy and I decided to hate the haters. Is this meta or imbecilic? Tantrum throwing nihilists, cutting themselves sharper and sharper in their opposition, slicing fat to isolate the point, piercing and piercing again. Ideological fundmentalism, how is this any different? How is the screaming child pushed into art and science any better than the screaming child pushed out of it? Both of their victims consider the attack unprovoked. Emotional-territorial, both hiss like scared ferrets. How on earth is your screaming, furious music any better?! You react with repugnace just as they react to your kind.

No child is given the option to crawl back into the womb. I never agreed to this. Press ganged into society "You will agree to submit to someone else's will", flakiest of rationales - "They're older, they're wiser, they were put there by God, it's tradition or old charter or something". Legions of automata like reverse cartoon characters - transforming themselves from humanoids into machines, cogs, wheels, more like a brain cell than a brain. Fire, fire, unthinking and unquestioning but still tied to biological programs that are so far out of date.

To cross again is *not* not to cross. I don't deserve my rights any less or more than anyone else.

I rant and I rave because it seems the lesser of the evil. I hate because it's a step closer to freedom - hatred of the system vs. systemized hatred. I demand a better life for myself because no one/thing will do it for me. It doesn't need to be this fucked up, and I am livid that people are dumb enough to think it does. I rail and rail again backwards, off the tracks, so much coal the engine explodes. I never agreed to this, fucked if I'd accept anything less. One life, one chance to carve a niche I can enjoy, one chance to experience something I find good. We can be better, we aren't (yet) and I hate it and I should.

BUT LIFE WASN'T MEANT TO BE FUN!!!!!!!!1 IT'S TOUGH AND UNFAIR!1!!11!!113413241311!!!!

fuck

that.

Come Down Music

2010-05-05T05:10:00.000-07:00

we'd like to congratulate our close friends, Come Down Music, who've also just released their first album for free online. It's not metal, I'm not sure I can imagine anything less metal, however it has helped me out many times when i've been unable to sleep due to having imbibed strange chemicals.

So for that they should be commended.

You can download their first album, appropriately named "First Album", from http://dropbunny.com/comedownmusic.html

Towards the free, legal, digital distribution of music

2010-05-04T07:26:00.000-07:00

drizzling alleyway.

"...but you've gotta check these guys out! It's metal, but these guys have a lot going on! Their music's actually about some intelligent stuff!"

"If they were that smart, they wouldn't be giving their music away from free."

This comment took me by surprise.

I'd been spending the last three hours sitting in an alleyway, behind a table with a red, gingham tablecloth, behind a large piece of cardboard with the words "RAAAWWR! Free metal cd!" spraypainted across it. A pile of albums and zines and rubik's cubes next to blaring speakers and a winamp visualisation.

"If they were that smart..."

The thing that horrified me the most from uni was when we learnt about the music industry's introduction of compact discs. At the time, cassettes cost around four bucks to manufacture, and were sold for between eight and twelve. When cds were first introducted, they only cost two dollars to press (a plastic disc being a lot cheaper to make than the fiddly, mechanical widgets inside a cassette tape).

Common sense suggests that when new technology makes manufacturing something cheaper, a proportion of that saving should be passed on to the customer. (LMAO, he's talking about economics, but referring to common sense!!)

As we all know, this didn't eventuate. The recording industry realised that people would be willing to pay a premium because the technology was better. This is the point where the industry moved from providing goods as cheaply as possible while still making a profit, to intentionally squeezing as much money out of consumers as they thought they could get away with. And not only did it work incredibly well, but it *continues* to work. In our age of constantly cheaper storage media, the only formats which are the same price as they were a decade ago are the cd and the dvd (the film industry uses this same business model). Curious, no?

At the risk of hyperbole, to me the recording industry feels like a microcosm for the failing of free-market capitalism as a whole: it's nice in theory, but in practice creates oligarchies more interested in a highly profitable status-quo than in competition.

"...they wouldn't be giving their music away for free."

I've heard this so so so many times, most notably from my old folks wailing incredulously, "Not only do you kids spend enough money to put a deposit on a house on a cd, but you're going to give it away for free?!?!?!?!"

In my brief time on this planet, the developed world has already changed dramatically thanks to the internet. The publication of art no longer behaves according to the "law" of supply and demand - any kid with a pc and a net connection can distribute infinitely many copies of their music. The cost of supply is as near to zero as makes no difference. This is a fantastic, beautiful development! Art is how humans communicate those experiences which aren't readily verbalised. How literally awesome that an artist's communications can be instantly transmitted to almost anyone in the world! How liberating that the traditional gatekeepers are rapidly becoming irrelevant!

CD sales have never been the primary source of revenue for musicians. In Australia, an album distributed by a record label needs to go gold (10,000 sales) before the musicians who perform on it make their first cent. The song writers earn their royalties whenever their songs are played: be it live, on radio, or streamed/downloaded from the net. This hasn't changed. Live performances and merch are still, and have always been, the main source of income for most musicians.

Any artist would obviously love to be able to afford to work full-time on their art, but bullying fans (via DRM, lawsuits, or even just inflated pricing in stores) is no way to acheive this. The distribution landscape has changed, and the idea of constructing artificial barriers between your music and the people who might enjoy it is a perversity that goes against the point of creating music.

Time will prove us right or wrong. Maybe Apple will invent new DRM software that gives you an electric shock whenever you listen to music you haven't paid for. Maybe the four of us will end up cynical, old paupers whining "I coulda been a contender, Charlie!" while every other indie musician becomes an overnight millionare. The fact is, the traditional music industry is currently sinking - and like all good rodents, dropbunny are getting the fuck off the ship.

you can still download our debut album 'Hypothesis' for free from dropbunny.com, or catch us in the alleyway next to Peril Underground, Elizabeth st, Melbourne every second weekend, for a free copy of the cd.

quickening of the abstract

2010-05-01T02:36:00.000-07:00

UPDATE: In all sincerity, i'd recommend most people skip this post. It's not funny, it's not clever.

This is a bunch of shit written down as the new album continues to crystalize. I'm not sure if it will be interesting to anyone - you have been warned! If it looks like pretentious art-fag psuedo-intellectual proselytizing then that's because it is. LMFAO oh dear "psuedo-intellectual proselytizing" wha?!?! YOU HAVE BEEN WARNED!

The background is that this follows directly from the last album.

Had been sleeping. How can you tell if it was all a dream? Pay more attention to the typeface? Writing in dreams is more honest in its treachery.

shifts and shifts and shifts again

the choice has been made, the path has been laid. The one act of creation shifted reality, the robot reacts as dead and dumb as ever. I see you there!

Following his tantrum throwing proclivities, he wails endlessly at the unfair world and the sleeping primates. While not entirely pointless, the only point is something very seperate. An extraverted nuerotic, his concience manifest in the roaring echos that return to him. The performer is the audience.

so it sings...

To be honest all this occult dribble is just trappings. Decisions had been made, eyes opened, magic worked, long before I considered following someone else's system.

There are similarities, to be sure. And referencing the known allows us to understand the unknown, but still.

I wish i could remember the first step. I think it was when Shem called me a bossy boots.

Volcano in my belly. I can't fucking believe she had a point about that.

So it starts like a calzone - take something you've seen before, let it fold over itself. The fact is reacting to your rage is rarely productive, it amounts to blind thrashing and is more in line with the terrified deaththroes of cattle than productive posthuman behaviour. Holding the rage, distilling, concentrating it, the allowing small precise droplets past your lips. Like science! The person who just sat down smells like poo.

That shit can move mountains, imolate cities, fire people into the sun. Like an orgasm - you have to have some restraint, hold it, hold it for the eart-shattering kaboom.

Magic like music like sex. Sounds like a fun weekend!

So that's the lesson learnt, grasshopper. We are now grade 7 and grade 10. Same again, HAL.

This is where it gets interesting. The trick top hat, i will create as i speak, disappearing forever into limbo, falling faster, faster,

reality takes a back-seat for a second.

busy bees

2010-04-26T01:08:00.000-07:00

Two new live clips: http://www.youtube.com/watch?v=91dIBk2lINo and http://www.youtube.com/watch?v=NL0c7VvJOno , plus one pointlessly offensive ad: http://www.youtube.com/watch?v=DEO6QkIsJVk

WHAT BUSY BEES WE ARE

brainbook 00009

2010-04-19T04:48:00.001-07:00

mouse off

"Oh, i'm between jobs at the moment...i've been out of work for a while, still not sure what I want to do. I'm enjoying not having the responsibility of a job, it's just that it gets so *boring* sometimes. I mean, you know what it's like? Nothing to do all day, you were unemployed recently.."

"Ha, yeah, but shit, i don't think i had time get bored! I was still pretty flat out even though i wasn't working." <- me being a bit of a dick

"Nah, but like, J's been out of work *six months*. You weren't out of work that long, but you know, after a while you get sooo bored! There's nothing to do! You go out of weekends, but during the day, there's nothing to do!"

"Are you serious?! I could be out of work for the rest of my life and I'd still never run out of things to do! There's so many books, languages to learn, like i'm still shithouse at violin, there's just so much to do!" <- me, well in my cups, crossing over to pretentious douche.

"No..you don't understand..."

NO I FUCKING DON'T.

This universe is so fucking big, and one lifetime so tiny. You can pick any field you like - sport, fashion, maths, science, art, theology, cooking, needlework, ANYTHING - and you could spend your entire lifetime learning more details, more intricacies. The reason fields are becoming increasingly specialised is because the wealth of human knowledge is more than anyone can grasp within a lifetime. You might be a master at genetics, but your knowledge of physics will be lacking, you won't know dick about art, maybe have a fleeting understanding of a few sports...thassit.

There are people who can unicycle, build houses, name where the grapes in the wine were grown from one sip, manufacture drugs, design rockets, speak well in public, remember pi to tens of thousand places, compose symphonies, run countries, walk across broken glass, heal the sick, swordfight, find food in the wilderness, photograph new species of fish, develop artificial intelligence, sing well, knit a jumper, blow up a building, stage a revolution, sit in quiet meditation while being doused in petrol and set alight.

"But there's nothing to do!"

There are no boring situations, just boring people. I know i sound like a self-important fuckwit, maybe humility's another skill I need to work on...but a lifetime is so very short! You only get an average of 2.5 billion *seconds*...you couldn't even meet 1/3rd of the people in the world for one second each. Are you really content to let your *ONE life* dribble away, without getting to know a bit about the space around you?

I'd be a bit disappointed if this surprisingly animate lump of flesh expired without having some idea of what the fuck just happened.

grapplesincircles the face appeared it didn't feel like it came from me this time, but it couldn't, couldn't be that, just getting a bit overexcited. Too many books, you're just too gullible, let it alone, just get on, breathe, keep focused, become one with geometry quiet quiet boom like a space cadet flying at a stone wall boom atoms implosion drifting away, who's thinking this the images flashing up and up cheeks pulled apart ready to split, violent automatons and empty rooms, so similar and yet, not sure if there's a head inside the jigsaw it didn't look like it. The film that tracks you brainwaves and becomes the absolute scariest thing your body can construct at this moment right now.

DID YOU KNOW?!

We're told in high school that the number Pi is infinite, and non-repeating (first million digits are here). This means that logically, somewhere, eventually, the decimal expansion of pi should contain *every possible string of numbers*. For instance, my home phone number appears in the first million digits. Eventually you should be able to find every phone number in the world. Also remember that every image, or song, can be represented by numbers on computer...so logically pi, somewhere, eventually, contains every image ever produced, every song ever written...not just that, but every song that ever *will* be written.

Pi is the number used to calculate the curvature of any round object. So every curve you can see contains pi, which contains every film or song which will ever be written in the universe. Somewhere, eventually.

Do you believe this?

brainbuku #00005

2010-04-04T20:54:00.000-07:00

Our glorious laws:

Seditious Intention

The definition of "seditious intention" originally in Section 24A has become (as amended):

An intention to use force or violence to effect any of the following purposes:

(a) to bring the Sovereign into hatred or contempt;

(b) to urge disaffection against the following:

(i) the Constitution;

(ii) the Government of the Commonwealth;

(iii) either House of the Parliament;

(c) to urge another person to attempt, otherwise than by lawful means, to procure a change to any matter established by law in the Commonwealth;

(d) to promote feelings of ill-will or hostility between different groups so as to threaten the peace, order and good government of the Commonwealth.

EVERYTHING IS EITHER BLACK OR WHITE
THERE IS NO GREY ANYWHERE

UP IS NOT DOWN LEFT IS NOT RIGHT YOU ARE NOT OK

Where is the line between urging disaffection against the Government and having a legitimate discussion as part of the political process? If someone (not me, obviously!) was to say "The Government is out to get you, and needs to be destroyed.", then that seems like it falls squarely into all of the above categories at once. However if someone said "The Government is out to get you, and needs to be destroyed." in quotes, then they're *referring* to the sentence, rather than *saying it themselves*. Tim said that everybody knows that anarchists believe that the Government is out to get you, and needs to be destroyed. If you refer to the sentence "the Government is out to get you, and needs to be destroyed" repeatedly, is that the same as saying it? The Government is out to get you, and needs to be destroyed. Does the previous senteance cross the line of legality? Obviously it's not the sort of thing i'd *ever* say myself, obviously! I obviously don't believe that *the Government is out to get you, and needs to be destroyed*. And I'm not being sarcastic about that, at all, obviously! Obviously!

uif Hpwfsonfou jt pvu up hfu zpv, boe offet up cf eftuspzfe.

Does the preceding sentence cross the line, or only if you move each letter back one (i.e u=t, i=h, f=e)? In which case, is that your fault or mine? What if i encode "THE GOVERNMENT IS OUT TO GET YOU AND NEEDS TO BE DESTROYED" as 1's and 0's and post it online? What if i encode it in pigments that cause a certain pattern of photons to be reflected from innocuous pieces of paper? Pemerintah mau membunuh kamu, dan harus dihancurkan. Is the previous sentence legal here, but illegal in indonesia? Would it be illegal if more Australians spoke Indonesian, and thus realised that it means "The Government is out to get you, and needs to be destroyed."? HOW MANY TIMES DO I HAVE TO SAY THE GOVERNMENT IS OUT TO GET YOU AND NEEDS TO BE DESTROYED BEFORE IT MEANS SOMETHING? Not that i ever *would* say it, obviously! I'm speaking hypothetically!

What if it turned that this whole time the sentence referred to Robert Mugabe's Government?

--------------------

Let's assume that someone (the courts? the police officers? God?) decides that the above paragraphs are not just a bunch of wanky art-students being facetious, but are actually an example of CRIMINAL BEHAVIOUR! Then let's convert each character in the offending paragraph into a number, say, its ASCII code (i.e 'W' = 87, 'h' = 104, 'e' = 101, spacebar = 32 etc). Then let's convert each number into a different shade of grey (somewhere between RGB(0,0,0) and RGB(255,255,255)). Then let's arrange all these shades of grey on a grid of squares, and put it below this paragraph.

If the above paragraph is seditious, is the image below? How do you know the image isn't just totally random grey squares, and that it wasn't *your decoding* which found the seditious paragraph, where there wasn't anything before?

IF YOU LOOK HARD ENOUGH AT ANYTHING, YOU CAN SEE EVERYTHING.

(meanwhile senator conroy still thinks you can censor the internet)

you'll keep

2010-03-29T05:25:00.000-07:00

don't even know hwat's going on

this screen in my head, everthing pressed back into fragments of 2d, so hard to tell what is and isn't me anymore. The shape of my limbs looks foreign, spiders crawling across the shifting geometry of the keyboard. It's very easy to forget that someone spent their time deciding the shapes of the letters of the alphabet, that someone had to spend long hours convincing others that *this here* is the way characters should appear.

The entire world fits snugly inside your skull. As far as you can see into the distance, know that the inside of your face is just beyond the horizon. The ultra-mega-hyper-reality-vision within a calcium wall, it's easy to confuse the film with the World Out There. Our eyesite so feeble compared to what it could be, so much radiation imperceptible.

I convinced myself that I was a triangle for an hour last night. On coming to I saw a bone coloured cat dart across my room and vanish. Straight out of fiction, and yet i *knew* the cat, like in a dream, the declarative knowledge comes so suddenly it could be innate. I know that cat.

I swear i'm not wigging out yet...there's so much of the world to see, and one life is so short. I don't want to waste it. There's 17000000000 seconds in a lifetime, and i don't want to waste even one. Wigging out is not my style, such a waste, so much you'd miss out on - having kids, retirement, making those goddamn string-theorists eat their hats when i publish my universal theory of everything. COP THAT FUCKING STRING THEORISTS I'LL FUCKING SHOW YOU! STRING?! BAH I SAY!!!

and again, if you're enjoying yourself, why stop?

Example 1

Example 2

p.s. i still can't figure out how, when they released vista, they managed to fuck up *notepad*. But it's buggy as shit, and consistently ruins my life! Whaaaaa?!

brainbook bebebebeb

2010-03-28T05:20:00.000-07:00

ON TIMELORDS AND RELATED SYSTEMS

We are so far removed from reality that the entirity of human endeavor has still not given us more than a blurred glimpse at what we're made of.

it's a great big wild world

i got 1 so now to make 0 on a higher level. It's the metaverse flowing outwards and up, jung's archetypes making us run rampant to a backwards big bang. How much reality can YOU handle?
i started somewhere it went for a while and keeps on going. I feel like i've gotten somewhere, but i'm aware that i'm barely aware of anything. How to deal with yourself as timelord?

That'll come later in the album.

It was the ultimate shock to the system - the realisation that the system is not the system it thought it was. Obliterated in the vastness of the universe....douglas adams was a very smart cookie. Coming out of the water, up for air. Do you ever stop to think how radical are the repercussions of some electrons colliding down an axon?! With the blink of tens of nueral pathways, whole worlds are shattered. Creatures die and are given life, inanimate systems move, colours change and air molecules vibrate in a synchronicity that would never have been known otherwise. With five million red blood cells per cubic millimeter, how much of reality this small grey matter controls?!

We can't control our perceptions, evolution decided that for us long before we had a vote. What we do with our perceptions, and what we choose to perceive - that's our legacy, and large and small enough to move or not move mountains. We find ourselves running at higher and higher frequencies, with greater control of what we see...but the aeons old questions still end in insoluble recursion. The preceding sentence is false. X = X squared. It's been a hard day's night, yet i've been spinning like a log graph.

abrahadabra - i will create as i speak. The rock that's so heavy.

There's a new story starting - it begins a level lower than this, and ends a level higher. It's our new album, and we hope you enjoy it a lot. I'm very excited about it, but then i'm hardly an unbiased observer. In the meanwhile, we have some more shows up, so check them out if you feel like it.

conjunctivitis

2010-02-21T01:16:00.000-08:00

open valves, the rage comes torrential, fire breath crisping up the zombie persecutors - watch the skin harden and crack and float serenely on the hot air.

i heard reality shifted focus fuckus folk us faux cuss geometry again but the queen has to mean something, doesn't it? Not magic but violence, the sounds from the abyss !i!i!i!i!i!i socrates again it just never stops. Joyce would be so proud! Every letter is an organ, every organ is a force, every force is information. By interacting, two entities show something of themselves - the wavelength of a photon tells you the color of the object it bounced off. If you look hard enough at anything, you can see everything.

I bent my arm through itself a couple of days ago. It was a surprising accident, because i had previous been convinced that such things were impossible. Whoops! It clicked out of space most unexpectedly, although i was a little preoccupied at the time, so tried to ignore it - reasoning that my arm would return to its proper dimensions soon enough. Which happily was the case - i wouldn't much like to lose a limb to hyperspace! I mean, at least a car accident or something could gain you some sympathy from friends and colleagues. "Sorry, i can't come to work today, my arm decided the confines of Spaceship Earth were too constricting, and is now exploring the improbabilities of string theory in N-dimensional space." "Very funny, Jones. See you at 8am sharp." See? That's not a conversation i was looking forward to having.

Overall the experience was not unpleasant - a little like losing a milk tooth. It happened very suddenly, SNAP! I watched slightly tremulously as my former arm snaked its way up to the roof of my living room, like some cross between a stinging nettle and a pretzel, curving back and in, and bending in ways that my visual cortex was frankly unable to cope with. The sensation from my nervous system was a pleasant mix burning and marshmallow. My former arm continued frolicking on the living room ceiling for the better part of an hour, before slowly reattaching itself to my confused shoulder.

It has given me a profound insight into current affairs programs.

A PROFOUND INSIGHT INTO CURRENT AFFAIRS PROGRAMS

HURRRRRSQUEELSHTIFARRRRQUACGLEGLUEFUCKINGTERRORPUPPIESGRINDINGRINDINGRINDINGMESSPILLOWDUMBDUMBDUMBHURRRRRRIWANTTOEATYOURBABIESLIPSTICKHEADMASSIVEDOOFDOOFDOOFSKULLPUNCHGRINDINGBELTCHBLEATVERBVERBYABBERANDCOMINGUPNEXTCATERWAULWALLSINKINGSTINKFLESHPASTRYRUNNINGCUT
CANDYCANETERRORTERRORYOUGOTSTOHANGONTOYOURMAGUFFINSPRARIEFELTCHFELTCHFELTCHURRRRRRFUCKINGFISTFUCARRYMEAWAYSWEETSUGARMELTINGSPECTACLESHURRRRRIHAVEABRIEFCASEIHAVEYOURSOULCONFESSSPITTNIGSLUSGHHSSGURGLEGURGLEBLLLSSSTHEAVYFLYWEIGHTOMNOMNOMAREN'TWELUCKYDONOTDOUBTHURRRRRRSUCKLESUCKSUCKFUCKINGFACEPLANTFLORANDFAWWWWNNNINGPATRIARTICLEDEATHBEDSCRAPESCRAPEGRINDINGRINDINGTREPANNINGFORFUNANDPROFITCUT
TEETHLIPSHAIRWAGGLEBOUNCINGLIGHTSANDSPARKLESLIKEGODFUCKINGMELTVISIONDYEFLAVOUREDMACKNDANDYSQUISHSQUISHSLOPANDBARFIGHTNIGHTINGSURGICALFIRSTANDNOWCANWEPLEASEFLUXSTAIDPLAIDYINGSHEDATEARSHEDSHEDSHQUALSHLOPSCHLOPPASTRYMANNERLOOKNOWWOWBIFFOAREN'TWELUCKYTASTETHESINCERITYBELCHUUURRRRSRSSSSSSAREYOUSCAREDYETHURRRRRRRRRRRRRRRPINCAKEFLAVOUREDYEMEFUCKINGTREPPANINGHOLEAPPEARANDTHANKSFORJOININGUSDERr

first filmclip!

2010-01-03T18:49:00.000-08:00

HUZZAH we've just managed to finish the filmclip for A Beginner's Guide to Self Destruction, off our Hypothesis album. WOW FUCKIN WEE! It has given us an amazing insight into just how painful video editing tools are, and how surprisingly easy it is to con our friends into making fools of themselves on camera. And noted with some dismay at how little convincing it takes certain people to light certain other peoples' heads on fire.

Unfortunately we also have very sad news, in that our lovely guitarist, seen so joyously attacking himself and the floor in the above clip, has decided to head off to England to live. Sad day! However if anyone out there thinks they can compete with his manic, arhythmic flailings and excellent guitar skillz, feel free to buzz us on 0405602375. Zap!

2009-10-06T05:13:00.000-07:00

start again.

episcopizzalian ridiculous ridiculous you could ridicule someone for that you know, just don't let it be you first, never let it be you first, something will happen, the world will explode, you've gotta watch out it'll come for you when you least expect it, they're everywhere, hiding in the airbrushes waiting to come out of the closet and snatch you away again and again and then you'll never get back again.

i used to wonder about the phrase 'you can never go home again' and think it was just a bit dicky. But lately i've been thinking it a lot - i don't think that means anything but it might not.

the worst thing anyone can do is make art that their parents appreciate, i think. I'm sure neitchze would agree, although maybe after his failed affair with wagner he got so bitter he changed his mind (neitchze bitter?! White != black?!)

maps, territories...i got trapped in a vortex the other night thinking about such things. I wanted to know what anything is at its most fundamental, but in order to know something is something, you need to compare it to something you know, which just makes my brain hurt to think about. There was also an interesting article today where they asked in 150 words or less what some of the most well known modern psychologists and nueroscientists fretted about not knowing about themselves. I found it a little disappointing that despite the ludicrous and exciting advances in science and philosophy in the previous several centuries, that most of the answers were things that people have grappled with from at least 300BC (as far as i've read, i'm sure neanderthals also wondered about the point of it all).

cut cut cut everyone finds their own variety of masochism (if all are one all sex is masturbation, if all are one all violence is masochism) gentrify the meaningless put puns in your porrige and let's have a good, fair game, fellas.

brain like a heartbeat, open, close, relax, push pump force forward more moremore go. Need to find the plywood in my knuckles for the next communication...but how reliable are memories anyway? The angry philosopher in the temple of mirrors, glaring at himself with the most furious impotence. It shifts up and back.

i'm trying to paint pictures of photons by showing where they *aren't*. I'm a dreadful artist so i can only be sure that it's not really what it's supposed to be.

the reason buddhists can be so serene is because they're so violent. Buddha is easily the most evil person i've heard about - he destroyed everything that exists, everthing that doesn't, didn't consider his work complete until he'd totally destroyed himself. Then had the gaul to suggest that there are better Ways than his, if only you can find new things to destroy. Crowley at least created things *some* of the time! if the shadow selves had any idea the lengths we go to persecute them, they'd be well afeared.

bb#3

2009-10-06T04:31:00.000-07:00

FYI this is possibly not sufficiently angsty to be of interest to anyone who might read it.

gobsmacked in the jello moulding shift cycle allusion to something, doesn't quite fit the quackery, when she was born they broke the molten fire pit, drop in the ocean, piss in the handbag and call it ridiculous.

it always starts with something incomprehensible, need the right filters to bring it back, to make the chaos look like something approaching pattern. I turn atoms into plaid, buddha was a redneck...certainly a weapon of mass destruction. In one way the most evil person i'm aware of...destroyed absolutely everything and only considered his work complete when he had destroyed himself, but continued to preach that there were better ways then his, if only people could find new things to destroy! Crowley at least spent some time creating! The shadow selves would be afeared if they realised the lengths we go to just to persecute them.

i went for a walk and it was lovely. i don't know exactly how i filtered the barrage of photons and air molecules that assaulted the organs that converted them into electrochemical reactions in my nervous system, but however i did it, it was pretty swell. Shall have to do it again.

need to get around to ordering 'i am a strange loop' by hofstadter...must not forget again...

I left a pile of shit on my neighbour's front doorstep. He caught me running off, and yelled out "Very clever...you realise i've got two dogs and know how to handle dog shit". As he picked it up with a plastic bag over his hand, i told him it was mine. He yelped, flailed, the man-chorizo flying straight towards a passerby. I don't think there's a lesson in this anywhere, it's just a bit dumb.

A lot of people argue that there's no such thing as a real fractal. The argument seems to hinge on the assumption that there is a fundamental particle that everything is made out of. So, for instance, if you line up two mirrors facing each other, it might *look* like an infinite corridor of smaller and smaller mirrors going off into eternity, but *actually* it only goes until you get to a 'mirror' the size of a photon, at which point the photons coming back and forth between the two mirrors interfere, and so you don't get any smaller mirrors anymore (just, presumably, a photon sized blank patch). Actually that's a bad example because it makes sense, and i was trying to disagree with that viewpoint. Shit!

I was wanting to think of a different example of a fractal in nature which could go smaller than the size of a photon, but unfortunately can't at the moment, which means i'll have to sadly concede that there mightn't be such thing as a real fractal. Which is exactly the opposite of what i wanted to argue here, but stiff shit evidently! I do still like to think that there's no such thing as a fundamental particle, that the universe just keeps getting smaller and smaller forever, although apparently that's impossible because "all the energy would get sucked out the bottom" and you'd end up with a universe entirely devoid of anything. I don't really understand this argument, which is why i don't agree with it at the moment.

water bears are more fun. They are incredibly cute, despite being microscopic. I like to think that they float around in my drinking water looking for honey and getting into adventures, stoicly attacking microscopic humans whenever the humans encroach on the bears' territory (possibly with microscopic logging activities to build microscopic furniture for the microscopic cubicles they work in).

Just thinking about it makes me thirsty.

UPDATE: Since originally writing this post I've found proof (to my own satisfaction) that any "fundamental" particle is physically impossible. However, as most people I've been speaking with over the last year would consider this mind-numbingly self-evident, I shan't bother!

Suffice it to say that it's sometimes hard to feel impressive when you're impressed by the people around you. BUT, it's easy to feel competitive >=D

cd finally finished

2009-09-26T22:38:00.000-07:00

**finally** we've finished that ridiculous fucking album. It's available for free download @ www.dropbunny.com/songs.html if anyone's interested.

Noise Bar gig - 18th July

2009-07-13T20:59:00.000-07:00

shitfucker on a stick

2009-07-09T05:03:00.000-07:00

We were hoping to have our first album Hypothesis up for free download by now...mentioned it in Inpress because we were sooooooo excciiiittteeedddd! But unfortunately it's fallen through...we've still gotta put one last day in the studio to get the cd as good as funds will allow, then it's gotta be mastered....so it's a little way off yet.

New gig at here 18th July, Noise Bar. Pitow!!!

brainbook pamphlet #00002

2009-07-02T15:35:00.000-07:00

RANDDODOMDMM

Achetypes, if you can find a wall you can break it down. The trick is finding the box that confines you, and looking at it from the outside.

How to make something interesting? You keep trying to cater to yourself. The most interesting things are interesting regardless of if there's anyone there to see it.

i spasm while trying to reconcile what happens inside with what happens out there.

"don't blame her, she does not what she knows"

i'm gonna put anthrax in the water supply, life will go on without us, the most interesting things are interesting even when noone sees them. Shit on a goat and call it pappy. Everyone likes magic, because everyone likes to be fooled. Rupert Murdoch as Houdini while we drown in the locked tank. I always try to piss when I come.

it comes in waves. Let the kid have a magazine or *something*.

Spacesuits, break the world into fractals. Song like rehearsal....song like writing a song....song like inventing the idea of music. Broken tweed, disintegrate dis ii n t e gg r aa tzzzqqqqq3456||||||||

The cell doesn't choose to be wiped out by antibiotics, the neurons guide the hand that blows the brain to atoms. Nations kill their people like an aids affliected immune system kills itself. Every interaction comes back to dom and sub. Misanthropy pulls the skin taut between my hand and feet, the uncaring wind throws a body into the stratosphere again and over again. This isn't even the half of it, a speck of black in what would otherwise be a pure white teardrop. The world spins on in all its glorious glory.

i can't deny that life isn't the most wonderful thing to live through.

i also can't deny that only a pretentious cocksucker would write this masturbatory bullshit. Aw heck!

gig @ arthouse, wed 8th july

2009-06-29T06:50:00.000-07:00

er...probably don't need to add much more than the heading @_@ We're playing with An Easier Question and The Plague Black at The Arthouse, 616 Elizabeth St Melbourne. Doors open at 8, $6 entry, yada yada.

you can get exactly this information, but with an added picture of our friend strangling himself on a streamer at www.dropbunny.com/gigs.html

whoooooie!

brainbook pamphlet #00001

2009-06-26T02:22:00.000-07:00

there is a problem with your face, it's back to front

you should fix it with fire

my voids stare into the eye of cosmo in terror, it happens now and again and i can't drag awa, like something from a bad novel, i keep worrying i'm about to burst into song.

i still haven't woken up, every day it's a dream within a dream within a dream within a...one day, however! I'm still optimistic that there's a roof on the universe, i know there's not but i keep

looking anyway.
pretentious asswipe
rambling random permutations
what a load of shite

children grow up to feed their parents, my rage cannot be quantified, cannot be more useless. Everything makes everything else stronger.

we're all painfully familiar with the notion of 'consumerism', the idea that we're bred like battery hens to make money for people with money, society as pyramid scheme, society as cancer, humanity destroying its planet, itself, bad bad bad things of that nature. Yet we don't stop! Noone wants to do bad things, everyone always does what they think is the best thing to do at the time. Why, if everyone is always doing what seems to be the 'right' thing, don't we have a utopia? We pride ourselves that we're no longer so uncivilised as to have religious crusades, but we invade the same countries today with the same doctrine of 'civilising' the area, still demonise the same people because of their religious beliefs (if you're an atheist you're a nut, if you're islamic you're a terrorist). WHYWHYWHYWHYFUKCKINGCOCKSUCKING PIECE OF SHIT FUCKINGWHYWHWYWHWHYWWHLOFSDLNAFNLALNEFARRRRGHGHGHHGHGHG!!

We know we're being lied to but we play along, we know that none of this shit matters but we pretend it does, we dance like marrionettes according to whatever the translucent god Society decides is acceptable, eyes open but unbelieving. None of this is new, you know it, you know you know it, yetttttttt

Cocksucker!!!!

it was all directly caused by the big bang
the logos

the universe is turtles all the way down, the further you zoom in on anything, the less tangible it gets. There is nothing here. Socrates could slice himself out of existence, he just didn't go far enough. There is nothing here.

Pornstar superman, decaying in the cosmic soup of gingivitis. I know not what i do! but there is an escape, there's always an escape getoutgetougetougetougetougetougetougetougetougetougetougetougetougetougetougetougeotougegtggetougetougteougtougteougteougteougeougetougetougteougteougteougteougteougteougteougteoutgetougteoutgeoutgoteugtougteoguteoguetogttgtgtgggagggatggttctcgtatcgatcgatcgatcgtagctagctgagcgagcgagcgcgcgtctctttctatagcacactacatcatcatcatcatcatcatcatcatcagcggcggatctacgactagctacgtatctatcatctacgtacgtactagctacgtacgtacgtacgtacgatgcatcgatcgtacgtacgtacgtacgatgctagctagctacgtacgtagctacgtacgatcgatcggcggactactactgtacgatcgacgctagcatgcatgcatgctagcatgcatcgatgctgac

Fact of the Day!

Did you know, Pi can be calculated using the following formula:

Pi/4 = 1 - 1/3 + 1/5 - 1/7 + 1/9 - 1/11 + 1/13 - 1/15 + 1/17 - 1/19...etcetc ad infinitum. So basically you add and subtract 1 divided by every odd number up to infinity, then multiply the whole lot by 4, and you have pi. So far we have managed to calculate it to over a trillion digits, but we still don't know *exactly* what the value of pi is, because you need to calculate an infinite number of fractions and chuck em together to find out.

As you remember from school, the circumference of a circle is pi time the circle's diameter. Every round thing is round because of pi, every curve can only be fully figured out by calculating infinite numbers. The humble circle is still so complex that it's physically impossible for us to ever be able to calculate it fully.

The universe is doing this sort of batshit stuff all the time.

New dropbunny website

2009-06-23T06:45:00.000-07:00

The all new dropbunny website is up and running. www.dropbunny.com